98 output coding for the guessing game machine using don t cares
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
Ngày tải lên :
08/03/2014, 08:20
... oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA ... HuD into the eukaryotic expression vector pTRE The promoter activity is controlled by the tetracycline-controlled transactivator (tTA) This construct (pTRE-HuD) was transiently transfected into ... fibroblasts This might be due to the fact that in vitro binding of the 52 nt CU-element by ELAV proteins may not reflect the physiological situation, i.e treatment with PDB This interaction might be...
- 16
- 754
- 0
Báo cáo khoa học: Complex alternative splicing of the hKLK3 gene coding for the tumor marker PSA (prostate-specific-antigen) ppt
Ngày tải lên :
23/03/2014, 20:22
... CAGAGAGCTGGCAGTTGTGGCTGG CATGGCTGCCTGGGTCTCCATCTG CAGGCCCATCCCGTGCGTGTG AAGCGTGATCTTGCTGGGTCGGCA CACTCCTCTGGTTCAATGCTGCCC GAGTGTACGCCTGGGCCAGATG TGGACCCCACCTGGTTCCTTGG TGCCGATGGTCCTCCAT CTATCTTTCAGACCTGGACAGGC ... Intron Exon Intron Intron Exon Exon Intron Intron Exon3alt Exon2-Exon3 Exon Exon4-Intron4 CACCCGGAGAGCTGTGTCACC GGGGTTGGCCACGATGGTGTC TGGACCCCACCTGGTTCCTTGG GACACCTCCTCTCCAGGGCAC CTCCTCTGGTTCAATGCTGGAG ... site This algorithm did not detect the alternative acceptor sequence used for transcripts k3c-d and, the real sites defining the boundaries of introns and 3¢ This suggests that the splice sites...
- 9
- 349
- 0
Báo cáo hóa học: " Research Article Joint Channel-Network Coding for the Gaussian Two-Way Two-Relay Network" docx
Ngày tải lên :
21/06/2014, 17:20
... j (t) = ζ j hT j XA (t) + hT j XB (t) + Z j (t) A B (25) is then transmitted in the second stage At the end of the second stage, each terminal, who has the information of itself, subtracts the ... the messages of the terminals, and in both schemes the sum rate is subject to the sum rate constraint in the MAC channel in the first phase The multiplexing gains of both the HLC and HMC strategies ... the information rates achievable by the proposed strategies in Section with the cut-set outer bound in [29] Since the derivation is straightforward, we state the outer bound without proof For i,...
- 13
- 451
- 0
Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx
Ngày tải lên :
20/06/2014, 22:20
... 96 monitored by TLC, ethyl acetate (2 × 10 mL) was added to the reaction mixture and filtered to separate the Bi2O3 The filtrate was concentrated down to approx mL, then added water to it when ... decreased the rate and yield of the reaction We have also checked the reusability of the catalyst using the recovered Bi O from the reaction It is observed that recovered catalyst could be satisfactorily ... a mortar with a pestle for the required period of time On completion of the reaction as Table Reusability of Bi2O3 in the preparation of 2b using 60 mol% of the catalyst Entry Run number Time...
- 6
- 591
- 1
Báo cáo y học: " Identification of a novel motif responsible for the distinctive transforming activity of human T-cell leukemia virus (HTLV) type 1 Tax1 protein from HTLV-2 Tax2" pps
Ngày tải lên :
12/08/2014, 23:22
... Tax1 Therefore, the functions through the Tax1(225-232) region may be constitutively active in Rat-1, or they may not be needed in the transformation of Rat-1 In support of the former hypothesis, ... A) http://www.retrovirology.com/content/6/1/83 Tax Figure The transforming activities of the Tax1 chimeric proteins with Tax2B The transforming activities of the Tax1 chimeric proteins with Tax2B ... Tax2B regions, but not the exchange of either one, reduces the transforming activity, and that the Tax1(185-207) region by itself has a negative function for the transforming activity The amino acid...
- 11
- 548
- 0
Báo cáo y học: "Improved base calling for the Illumina Genome Analyzer using machine learning strategies" pps
Ngày tải lên :
14/08/2014, 21:21
... verify the result of the training by using the test data set with the trained models and comparing the predicted labels with the ones obtained from the reference sequence Evaluating this information, ... A2 support the assumption that training on the PhiX extends well to the prediction of other lanes using the same estimated models To further verify this, we also tested with several other sequencing ... directly from the data using statistical learners and a training data set derived from the Bustard output Previous approaches [2,3] corrected raw intensities prior to the application of the statistical...
- 9
- 342
- 0
A new solution approach for the inventory routing problem using vehicle routing problem constructive heuristic
Ngày tải lên :
16/09/2015, 15:43
... Finally, it is important to note that, by applying the two partitionings, we cannot generate more than T + T = × T loads These three properties can be grouped together for further use: Theorem At the ... value that leaves the final inventory empty Let us define, for notational convenience the cumulated deliveries made to customer i: t Qt (i) = kt qi t =1 k∈K With these notations, Qt (i) is the total ... be often referred to For clarity, these quantities will be denoted with the CAPITAL letter of the original variable, and a superscript indicating the last term on the summation For example, the...
- 109
- 483
- 0
Information transfer activities for the teaching of reading using Tieng Anh 11 at Nguyen Du high school in Ha Tinh province
Ngày tải lên :
08/11/2015, 18:54
... student wants to exploit the full content of the text, he/she must be able to understand the separate ideas as well as to reconstruct the text Therefore, a lot of teachers thought the information- ... structure - to clarify text content The teacher, at the while reading stage , needs to help their students comprehend the text thoroughly whlie the students have to apply to the best their reading ... before doing any other activities On the contrary, out of 10 investigated teachers argued that students don t have to master the text contents clearly but just grasp the general ideas of the texts...
- 79
- 1.8K
- 1
Creating 3D Game Art for the iPhone with Unity Part 8 potx
Ngày tải lên :
08/08/2014, 13:21
... Quality for the Lightmap 195 Creating 3D Game Art for the iPhone with Unity We’ll talk about the important settings in the next section, but I’d like to point out that for my project, I€set the ... up the bake and allow you to quickly see the map applied to the geometry The Quality will also adjust the Final Gather rays that are sent into the scene The more the rays are shot out into the ... adjusting the Scale in Lightmap setting in the Object tab of the Lightmap Editor as shown in Fig 8.17 The great thing is that this procedure is completely interactive Just select the object, adjust the...
- 28
- 359
- 0
Creating 3D Game Art for the iPhone with Unity Part 9 ppsx
Ngày tải lên :
08/08/2014, 13:21
... from the Desktop version of Unity iOS and tweaked it to the desired settings and positioned the Emitter at the center of the target Next, I disabled the Emit parameter and activated One Shot so that ... 8.33╇ The Secondary Dirt Layer Was Used to Create Accumulation in the Corners and at the Base of the Walls In Photoshop, you can then adjust the strength of the dirt by adjusting the opacity of the ... immediately falling to the ground due to gravity when the game starts Next, we have an Explode function that is called when the Ray shot from the Raycast collides with the HitTest object as mentioned...
- 28
- 352
- 0
Network Administration for the Solaris 9 Operating Environment SA-399 Student Guide phần 8 ppsx
Ngày tải lên :
12/08/2014, 22:21
... the trace data to ASCII text, and output that text to the /tmp/dhcp-snoop1.txt file for viewing with any text editor that allows for easy navigation and searching of the data Use the view utility ... Client Reboot the DHCP client system After the DHCP client is booted, stop the snoop utility by pressing Control-C View the summary of the captured information Use the snoop utility to convert the ... observe the network interaction between the server and the client To view DHCP client-server interaction, complete the following steps: 11-40 Start the snoop utility on any system on the subnet other...
- 60
- 209
- 0
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens
Ngày tải lên :
05/09/2013, 08:40
... variety of mutagens that were not detected in the standard tester strains They are suitable for mutagenicity of aromatic hydrocarbons, allyl hydrocarbons and insecticides, but not suitable for that ... supported by the research project The research on the development of the total evaluation technique for the hazardous impacts by the chemical substances towards human and ecology (the project leader ... that of herbicides, fumigants, heavy metals, inorganic chemicals and natural toxins, etc These results may suggest that the utility and limitations of both the Ames test and 8-OHGua assay in detecting...
- 6
- 735
- 0
CHICKEN SOUP FOR THE SOUL ( song ngữ) Phần 8
Ngày tải lên :
20/10/2013, 14:15
... 101 items on my list It took me almost two years, but became the springboard and true inspiration for my career as a conflict mediator No matter how difficult the conflict, crisis or situation, ... remember that it's never too late to clear up the past and begin resolution Marilyn Manning Each experience through which we pass operates for our good This is a correct attitude to adopt and we must ... After drinking a few beers, we found a can of red paint, climbed the public water tank in the midle of town, and wrote, on the tank, in bright red letters: Sheriff Brown is an s.o.b The next...
- 6
- 3.9K
- 65
TEST FOR THE FIRST SEMESTER - E .8
Ngày tải lên :
30/10/2013, 20:11
... he later emigrated first to Canada and then to the USA in the 1870s Bell is best known for his invention of the telephone Bell and his assisstant, Thomas Watson, conducted many experiments and ... Complete the sentence Alexander G.Bell was born in………………………… He emigrated first to ………………… and then to the ……………………… in the 1870s The first telephone was introduced in………………………… * Answer the questions ... came up with a device which they first introduced in 1876 Bell said on the phone: “ Mr Watson, come here I want you ” This is the first telephone message .The first telephone company, Bell Telephone...
- 2
- 1K
- 2